Forum: What Are The Most Common Stupid Mistakes In Bioinformatics?
100
gravatar for Jeremy Leipzig
9.3 years ago by
Philadelphia, PA
Jeremy Leipzig19k wrote:

While I of course never have stupid mistakes...ahem...I have many "friends" who:

  1. forget to check both strands
  2. generate random genomic sites without avoiding masked (NNN) gaps
  3. confuse genome freezes and even species

but I'm sure there are some other very common pitfalls that are unique to bioinformatics programming. What are your favorites?

forum software • 33k views
ADD COMMENTlink modified 6 weeks ago by zx87549.4k • written 9.3 years ago by Jeremy Leipzig19k
16

Staying in the office all day

ADD REPLYlink written 5.0 years ago by russhh5.4k
8

good way to boost reputation.

ADD REPLYlink written 8.2 years ago by Raygozak1.3k
3

meta: should this Q be community-wiki?

ADD REPLYlink written 9.3 years ago by Chris Miller21k
1

what's the mean by said generate random genomic sites without avoiding masked (NNN) gaps? more detailed? do not understand.

ADD REPLYlink written 8.1 years ago by Zhilong Jia1.6k
1

see this?

http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chr1:1,10000

you wouldn't want to sample from it

ADD REPLYlink modified 8.1 years ago • written 8.1 years ago by Jeremy Leipzig19k
94
gravatar for iw9oel_ad
9.3 years ago by
iw9oel_ad6.1k
iw9oel_ad6.1k wrote:

Invent a new weakly defined, internally redundant, ambiguous, bulky fruit salad of a data format. Again.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by iw9oel_ad6.1k

We should work on a standard .. I keep saying that but no one would hear me anyway

Laughs & Tears ~!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by madkitty600
9

http://xkcd.com/927/

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Daniel Standage3.9k
1

It made me laugh when I read the MIQE guidelines not long after this comic came out:

The nomenclature describing the fractional PCR cycle used for quantification is inconsistent, with threshold cycle (Ct), crossing point (Cp),and take-off point (TOP) currently used in the literature ... we propose the use of quantification cycle (Cq)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by dominic10
70
gravatar for brentp
9.3 years ago by
brentp23k
Salt Lake City, UT
brentp23k wrote:

I truncated many fasta files this way when trying to see which headers it contained:

grep > some.fasta

I also see a lot of off-by-one errors due to switching between formats

  • Bed is 0 based
  • GFF/GTF are 1-based

and switching between languages:

  • Python and nearly every other modern language are 0-based indexing
  • R is 1-based (as is Lua)
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by brentp23k
9

Not only is the bed format 0-based, it's also "half-open", meaning the start position is inclusive, but the end position is not.

So if your region starts at position 100 and ends at 101 using standard 1-based coordinates with both start and end inclusive (ie it's two bases long), when you convert it to 0-based half-open coords for bed format the region now starts at 99 but it still ends at 101!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Nina380

Yeah, the people who conceived of that were utterly brilliant usability specialists.

ADD REPLYlink written 5 weeks ago by colindaven2.3k

YES, THAT IS an interesting feature when, as a bioinformatican, you're working with C-arrays , you want to define an empty interval, an insertion point, etc..

ADD REPLYlink written 5 weeks ago by Pierre Lindenbaum129k
51
gravatar for Fred Fleche
9.3 years ago by
Fred Fleche4.3k
Paris, France
Fred Fleche4.3k wrote:

Gene annotation stored in an excel file and find out that some HUGO gene names have been hacked by Excel. SEPT9 become sept-9. Conclusion Do not use the .xls format to store your data.

Listen people saying this eternal mistake "Hey these two sequences are 50% homologs"

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Fred Fleche4.3k
11

http://www.biomedcentral.com/1471-2105/5/80

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Simon Cockell7.3k
3

This is a popular one, dec1 is another well known example. But you can actually tell Excel not to do that auto correction. Since you most often get the data from biologist who may have treated the data in Excel already better use an another ID column and not the gene name column if that is available (you often receive both anyway). These errors can even occur in databases that you download data from or which are used for annotation, so it is good to check.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Chris Evelo10k
2

"Hey these two sequences are 50% homologs"... I know. Whereas those are 45% homologs only ;-)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.6 years ago by Manu Prestat4.0k
1

The MARCH genes have tripped me up in the past. Using Excel/Calc etc is fine as long as gene name column is set to 'text' during import.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Ian5.6k

@Simon Thanks for the publication

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Fred Fleche4.3k

Uh oh. Looks like something was lost here in the migration.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Daniel Standage3.9k
43
gravatar for Casbon
9.3 years ago by
Casbon3.2k
Casbon3.2k wrote:

Reminds me of that old joke...

There are only two hard things in computer science: naming things, cache invalidation and off-by-one errors

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Casbon3.2k
32
gravatar for Jeremy Leipzig
9.3 years ago by
Philadelphia, PA
Jeremy Leipzig19k wrote:

I feel like a lot of "stupid mistakes" revolve around betrayed trust and false assumptions

For example:

  1. Trusting that a downloaded file is actually fully downloaded
  2. Trusting that an aligner will accept a list of query files instead of just taking the first and ignoring the rest (quiz: which ones am I talking about?)
  3. Assuming that the quality scores in a FASTQ file are from a great Sanger-encoded run instead of a very poor Illumina-1.3 run
  4. Assuming chr1 is followed by chr2 not chr10
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Jeremy Leipzig19k
10

I like the last item. :)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Yuri1.5k
30
gravatar for Casey Bergman
9.3 years ago by
Casey Bergman18k
Athens, GA, USA
Casey Bergman18k wrote:
  • off-by-one errors
  • regex errors
  • parsing a complex alignment/file format incorrectly (e.g. BLAST or GenBank, probably the original rationale for developing BioPerl)
  • failing to account for strand
  • failing to revcomp sequences
  • failing to account for the last element in a file (because of a improper loop condition or no EOL character on last line)
  • failing to account for OS dependent line breaks
  • using the wrong assembly/annotation/release
  • using the wrong genome coordinate system
  • using the wrong file (multiple versions, version skew)
  • failing to account for nested/intercalated annotation features (e.g. genes)
  • assuming all jobs have completed on a cluster
  • deleting files
  • not randomizing your data properly
  • improper use of statistical tests
  • not documenting methods fully (to check and correct all of the above)
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Casey Bergman18k
5

+1 for OS dependent line breaks. This still trips me up on occasion when I get files from other groups and find that (gasp) they use windows.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Wjeck480
30
gravatar for Ketil
9.3 years ago by
Ketil4.0k
Germany
Ketil4.0k wrote:

If you forgive an attempt to be somewhat provocative, my two favorite mistakes are:

  1. Letting academics build software

    Academics are in the need to publish papers, and one easy way to do that is to implement an algorithm, demonstrate that it works (more or less), and type it up in a manuscript. BT,DT. But robust and useful software requires a bit more than that, as evidenced by the sad state of affairs in typical bioinformatics software (I think I've managed to crash every de novo assembler I've tried, for instance. Not to mention countless hours spent trying - often in vain - to get software to compile and run). Unfortunately, you don't get a lot of academic credit for improved installation proceedures, testing, software manuals, or especially, debugging of complicated errors. Much better and productive to move on to the next publishable implementation.

  2. Letting academics build infrastructure

    Same argument as above, really. Academics are eager to apply to construct research infrastructures, but of course they aren't all that interested in doing old and boring stuff. So although today's needs might be satisfied by a $300 FTP server, they will usually start conjecturing about tomorrow's needs instead, and embark on ambitious, blue sky stuff that might result in papers, but not in actually useful tools. And even if you get a useful database or web application up and running (and published), there is little incentive to update or improve it, and it is usually left to bitrot, while the authors go off in search of the next publication.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Ketil4.0k
12

Yeah I don't know what why it is so hard for me to remember all the great bioinformatics software that has come from industry, like uhh Eland, or the great standards that have come from industry, like Phred-64 FASTQ.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Jeremy Leipzig19k
4

To be clear, it's not a problem with academics themselves (after all, I'm one), just that the incentives are all wrong...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Ketil4.0k
3

I am fine with point 2, but I have to disagree with 1. Your de novo assembler example is actually not a good one. De novo assembly is very complicated and highly data dependent. I doubt any assemblers work for any data sets, no matter developed by academia or by professional programmers.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by lh332k
2

Out of the (relatively few) tools I have experience with, bowtie/tophat/cufflinks and also fastqc are the exceptions in terms of documentation, UI, maintenance, non-brittleness.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by bw.150
1

I always wonder if they have ever check the program/code that come with paper. In one paper, they hardcode the input file in code, make me waste a whole afternoon to figure out what's the hell wrong with it.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Tg310

@Jeremy: I'm not so sure industry is much better, and it's possible that academia is the democracy of development - worst, except for the others. Also, a lot of industry software are add-ons, designed to sell something else. FWIW, Newbler seems to be one of the better assemblers out there, and CLC is at least half-decent as an analysis platform for non-informaticians.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Ketil4.0k
24
gravatar for Istvan Albert
9.3 years ago by
Istvan Albert ♦♦ 84k
University Park, USA
Istvan Albert ♦♦ 84k wrote:

IMHO being off by one is the emperor of all bioinformatics mistakes - it rules them all - and probably causes tens of millions of dollars in wasted effort

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Istvan Albert ♦♦ 84k
24
gravatar for Shellfishgene
9.1 years ago by
Shellfishgene290
Shellfishgene290 wrote:

Using grep to find sequence (or other) IDs without using the -w switch: grep 'seq12' will also find seq121, seq122 and so on.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Shellfishgene290
3

Yea, until you make the assumption that -w actually works only on whitespace.

printf "foo-choo" | grep -Fw -e "foo"

returns foo-choo. Hate that.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by sjneph620

indeed helpful

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by Gjain5.5k
2

This tip is helpful indeed!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.0 years ago by Zhaorong1.2k
23
gravatar for Zhaorong
9.1 years ago by
Zhaorong1.2k
State College, PA
Zhaorong1.2k wrote:

One mistake not unique to bioinformatics is: while editing one source file, compile and run another file.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Zhaorong1.2k
9

;) then hours debugging the wrong file

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by toni2.2k
3

ouch... brings back bad memories...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by kajendiran56120
1

oops.. I did that several times.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.8 years ago by bagdevi.mishra50
18
gravatar for Pierre Lindenbaum
9.3 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum129k wrote:

trying to solve any problem with BioPerl :-)

but the

  • '+1' error
  • and the grep > some.fasta

are my favorite mistakes.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Pierre Lindenbaum129k
12

s/Bioperl/perl/ ;) - haters gonna hate!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Casbon3.2k
1

why do you hate BioPerl :(?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by anin.gregory90
6

My top reason is that BioPerl is inefficient due to its OOP layer.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by lh332k
15
gravatar for Rayna
9.3 years ago by
Rayna250
Paris/Munich
Rayna250 wrote:

Try to open microarray or, worse, NGS datafiles with excel or word...

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Rayna250
15
gravatar for Zhidkov
9.1 years ago by
Zhidkov570
Israel
Zhidkov570 wrote:

Forget to do 'dos2unix' and then spend a lot of time trying to figure out why there is no OUTPUT

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Zhidkov570
1

Classic. This one tricked me 3 times over the course of two years, spending one hour each time to figure out what the h... is going on.

ADD REPLYlink modified 6 months ago by RamRS27k • written 6.2 years ago by Christian2.9k
14
gravatar for Andres Pinzon
9.1 years ago by
Andres Pinzon140
Colombia
Andres Pinzon140 wrote:

Well I have couple:

  1. Run a batch BLAST job and forgetting to put the -o something.out option. Then switching off the monitor and coming the next day to see a bunch of characters in my terminal
  2. tar -zxvf without checking the tar file before, I have decompressed thousands of files in my current directory assuming they came in their own folder.
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Andres Pinzon140
1

+1 for 2) mostly happens with downloaded software!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Naga450

Forget the tar problem, just use atool

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ryan Thompson3.4k
14
gravatar for Philipp Bayer
8.2 years ago by
Philipp Bayer6.7k
Australia/Perth/UWA
Philipp Bayer6.7k wrote:

Re-inventing the wheel. So often did I have to debug (or just replace) a bad implementation of a fasta-parser when BioPython/BioPerl have perfect implementations, I don't understand why no-one bothers to use them. 10 minutes in Google can save you 2 days of work and other people a week of work (you save 2 days of programming, they save a week of understanding your program to find the bug)

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Philipp Bayer6.7k
4

I agree too. Sometimes it's good for practicing purposes to keep on writing simple code, though.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.0 years ago by Manu Prestat4.0k
1

I fully agree, re-inventing the wheel is so tempting. We are way too eager to write a few lines of code each time. Plus, because you may have convinced yourself that you can resolve the code in 15 minutes, you don't bother about writing any documentation. In short, there is a very large tendency to re-invent the wheel... many, many times!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Javier Herrero290
1

Using other peoples code is all fun and games, until you realise that your package has 106 dependencies, and you only use 1 function from each. Each of those dependencies has its own dependencies, depends on a particular version of gcc (but not the same one as the others), doesn't play nice with some common system used on other peoples systems...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 2.8 years ago by i.sudbery8.2k
1

As the nim library docs say, "The great thing about re-inventing the wheel is that you can get a round one."

My main reason for reinventing the wheel is that I want to use much more powerful and general language: Python instead of R. Of course, if the stuff I needed was already in Python/Pandas it would be a different thing entirely.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by Endre Bakken Stovner890
12
gravatar for Manu Prestat
7.6 years ago by
Manu Prestat4.0k
Lyon, France
Manu Prestat4.0k wrote:

I gave my Amazon EC2 password to someone in my group who wanted to run something quickly (estimated cost, $2). I received the bill 2 months later: $156. This person forgot to close the instance. This is a 8 months story and I'm still waiting for my reimbursement... Conclusion: don't trust colleagues!

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.6 years ago by Manu Prestat4.0k
11
gravatar for Larry_Parnell
9.3 years ago by
Larry_Parnell16k
Boston, MA USA
Larry_Parnell16k wrote:

I'll offer this one, which is a bit on the general side: Deletion of data that appear to serve no relevance from the computational side, but which have importance to the biology/biologist. Often, this arises from a lack of clear communication between the two individuals/teams as to what everything means, what it exactly means and why it is relevant to the process being developed.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Larry_Parnell16k
9
gravatar for Gareth Palidwor
9.3 years ago by
Gareth Palidwor1.6k
Ottawa
Gareth Palidwor1.6k wrote:
  • having manual components to an analysis pipeline (editing data sets running scripts manually)
  • Not dealing with error conditions at all. This is one thing that I really noticed when I started with bioinformatics; code that would just merrily continue when it hit incorrect data and output gibberish or fail far away from the bad data. A debugging nightmare.
  • Not testing edge and corner cases for input data
  • Assuming that your input data is sane; I've run into all sorts of inconsistency issues with public data sets (i.e. protein domains at positions off the end of the protein, etc). Usually fixed promptly if you complain but you've got to find them first.
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Gareth Palidwor1.6k
9
gravatar for Zev.Kronenberg
8.2 years ago by
United States
Zev.Kronenberg11k wrote:

Not keeping an adequate notebook.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Zev.Kronenberg11k
2

What is a "notebook"?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by ebrown1955300
8
gravatar for Vince Buffalo
9.2 years ago by
Vince Buffalo460
Davis, CA
Vince Buffalo460 wrote:

One mistake: not looking to see that the 0x4 bit in the bitflag column of a SAM (or BAM) file indicates the entry is mapped. RNAME, CIGAR, and POS may be set to something non-null (an actual string!) but these are not meaningful if the 0x4 flag says the read is unmapped.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Vince Buffalo460

I've stepped in that bear trap. Learning to trust the bit flags is an important lesson!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.6 years ago by Zev.Kronenberg11k
7
gravatar for Daniel Standage
9.3 years ago by
Daniel Standage3.9k
Davis, California, USA
Daniel Standage3.9k wrote:

I often encounter problems related to the fact the computer scientists index their arrays starting with 0, while biologists index their sequences starting with 1. Simple concept that drives the noobs mad and even trips up more experienced scientists every once in a while.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Daniel Standage3.9k
7
gravatar for Chris Evelo
9.3 years ago by
Chris Evelo10k
Maastricht, The Netherlands
Chris Evelo10k wrote:

Do pathways statistics or gene set enrichment statistics and then represent the list of gene sets as a valuable result, instead using that statistics just as a means to decide which pathways need to be evaluated.

(This is bad for many reasons for instance because the statistical contribution of a key regulatory gene in a pathway is equal to that of 1 out 7 iso-enzymes that catalyze a non-relevant side reaction, and because the significance of a pathway changes when you add a few non-relevant genes, and also because we have many overlapping pathways).

Another typical mistake is to solve problems that nobody has.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Chris Evelo10k
2

these sound like poor judgments (e.g. Clinton-Lewinsky), not stupid mistakes (e.g. dangling chad)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Jeremy Leipzig19k
2

I would define a stupid mistake as falling prey to a trivial but catastrophic pitfall, an error in judgment is more due a fundamental lack of understanding or willful ignorance

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Jeremy Leipzig19k

No, I think it is actually wrong to publish a list of pathways without further judgement. I think not doing the judgement is a mistake. But I have to admit that I don't really understand your examples. So maybe my English is not good enough to understand the finesses of the difference between poor judgement and stupid mistakes.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Chris Evelo10k

In that case you are right, these would be judgement errors.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Chris Evelo10k
7
gravatar for Ian
9.2 years ago by
Ian5.6k
University of Manchester, UK
Ian5.6k wrote:

Masking out sequence in a FASTA file (e.g. s/TAAT/NNNN/ig) where the sequence is formatted, i.e. split onto multiple lines.

This will miss TAAT that is split over the end of one line and the start of the next!

The classic mistake (also mentioned above by Casey) is not being aware the genome assembly effect coordinates.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Ian5.6k
7
gravatar for Rm
8.2 years ago by
Rm8.0k
Danville, PA
Rm8.0k wrote:

using rm -rf * .fasta in unintended directory; especially if within the home directory...

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Rm8.0k
1

then do not use the recursive switch (-r) to delete files within the same directory :-P

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by toni2.2k
1

yes the space between * and .fa has bitten me as well. maybe there is an idiot guard against that somewhere?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Jeremy Leipzig19k
2

So this is a (very) late reply, but in case it's still helpful or someone comes across this question like I did, rm -ir will ask before deleting files. Maybe a little annoying to type y a hundred times, but better to do that than lose all your data to a mistyped glob IMHO.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 6.0 years ago by Duncan Murdock20
7

From my .bashrc:

alias cp='cp -i'
alias rm='rm -I'

Has saved me quite a bit of headache. The capital I prompts only when you remove more than three files - good when you accidentally type rm some_directory/ * (notice the space)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 6.0 years ago by Philipp Bayer6.7k

Ooh, I never knew about -I, thanks!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 6.0 years ago by Duncan Murdock20
1

I was about to add this one myself. It's bitten me a couple of times.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Travis2.8k
1

:) I did the same stupid thing many time!! I lost weeks of works by one click!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Mchimich260
1

I too have had that moment of dread when I realized I typed rm * /folder versus rm /folder/*! Check out some of the solutions on this forum page, specifically trash-cli. You can set up a trash folder so after deleting files they are not completely gone and can be restored if needed. You would have to manually empty the trash folder or set up a cron job to do so on a regular basis, but this may help circumvent the nightmares listed here!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.0 years ago by alolex910

I was just deleting some unnecessary files from a dir and managed to have a space and an asterisk at the end of the rm command. As soon as I realized what was happening I hit ctrl-c, but important files without backups were already gone. Oh well, it will only take like 2-3 weeks to reproduce them. Also time to edit .bashrc following Philipp's post..

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.1 years ago by 5heikki8.9k
1

Once I did something very similar: I deleted all files and subdirectories in a directory of which I thought I have them in duplicate. Shortly after I realized I was inside a symbolic link directory and I was deleting the original data....

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.1 years ago by Christian2.9k

Note that the really stupid mistake here is a bit hidden "important files without backups"

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 5.0 years ago by Chris Evelo10k
6
gravatar for Andrewjgrimm
9.3 years ago by
Andrewjgrimm440
Sydney, Australia
Andrewjgrimm440 wrote:

Having separate files for each sequence.

Of a 454 run.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Andrewjgrimm440

Or rather, using a file system that can't handle a few million files in a directory?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Ketil4.0k

I was using Ubuntu Linux. It "handled" it, just slowly.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.2 years ago by Andrewjgrimm440
6
gravatar for brentp
8.1 years ago by
brentp23k
Salt Lake City, UT
brentp23k wrote:

I wouldn't say it's stupid, but I think a very common mistake is to not correct for batch effects in high-throughput data.

Batch effects can (best-case) hide the real effect that you're looking for, or (worst-case) make it look like your variable of interest is contributing to your findings when it's actually an artifact.

Leek + Irizarry et al. have a sobering review on this here.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by brentp23k
5
gravatar for Thaman
9.3 years ago by
Thaman3.2k
Finland
Thaman3.2k wrote:

Generate Multiple Sequence Alignment direct from fasta or other file and ask: why there are no gaps & deletion in the MSA viewer?

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Thaman3.2k
5
gravatar for Blunders
9.3 years ago by
Blunders1.1k
Blunders1.1k wrote:

What kills me the most is the hand editing of data sets.

If you're reading this and do it, please stop -- and start using automated builds -- with clear documentation.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Blunders1.1k
5
gravatar for hadasa
9.3 years ago by
hadasa1.0k
hadasa1.0k wrote:
  1. Using excel to sort or manage your csv records.
  2. Using multiple alignments or highly diverse sequences or worst recombining sequences and inferring evolutionary history based on the resulting tree.
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by hadasa1.0k
5
gravatar for T S
8.5 years ago by
T S50
T S50 wrote:

developing algorithms and software around one single piece of low quality data with no prior knowledge while being ignorant about the entire problem.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.5 years ago by T S50
5
gravatar for Pascal
8.5 years ago by
Pascal1.5k
Barcelona
Pascal1.5k wrote:

Easy one: you wait for 4 hours downloading a big DNA file (e.g. bam file) and you mistakenly delete it when trying to move it with a good old rm.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.5 years ago by Pascal1.5k
5
gravatar for girlwithglasses
7.2 years ago by
Oakland, CA
girlwithglasses280 wrote:

Creating a new set of (public) identifiers for your database for entities that already have identifiers in a widely-user public db.

Having unstable identifiers that are publicly available.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by girlwithglasses280
1

Our paper, out this week, is a decent round up of how to avoid identifier-specific issues with your data and that of others. http://dx.doi.org/10.1371/journal.pbio.2001414

ADD REPLYlink written 3.0 years ago by mcmurry.julie50
4
gravatar for Jeremy Leipzig
9.1 years ago by
Philadelphia, PA
Jeremy Leipzig19k wrote:

tacking on another command line argument without looking through the rest of them

novoalign -a ATCTCGTATGCCGTCTTCTGCTTG -d genome.ndx -F ILMFQ -f query.fq -a -m -l 17 -h 60 -t 65 -o sam -o FullNW

the first adapter argument (-a ATCTCGTATGCCGTCTTCTGCTTG) is negated by the empty second one

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Jeremy Leipzig19k
4
gravatar for Niek De Klein
8.2 years ago by
Niek De Klein2.5k
Netherlands
Niek De Klein2.5k wrote:

Scripting an hour to do something you could have done in half an hour manually, and then never needing to repeat it again.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Niek De Klein2.5k
8

I tend to see the opposite not spending the time up-front to do it right and having to continue to do it manually/semi-manually ad nauseam

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by brentp23k
1

but that one is in here already

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by Niek De Klein2.5k

well, at the very least you may learn something that saves you an hour on a different project in the future

ADD REPLYlink written 3.3 years ago by cmdcolin1.3k
4
gravatar for Leonor Palmeira
8.0 years ago by
Leonor Palmeira3.7k
Liège, Belgium
Leonor Palmeira3.7k wrote:

I've just made one, which cost me a good headache trying to figure out the biology underlying my strange results!

  • expecting SAM's POS field to be the leftmost position of my mapped read on the '+' strand, and the rightmost position on the '-' strand

Note to self : "Read the manual..."

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Leonor Palmeira3.7k
1

not to mention how much work is to actually get the rightmost coordinate.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Istvan Albert ♦♦ 84k
1

Hah! I just reverse complemented the reference genome, and redid the alignment. Admittedly, this was for 454 data.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ketil4.0k

Hehe! That's the best idea ever! This thread keeps on giving.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Istvan Albert ♦♦ 84k

But you should be careful. Doing that will misplace the indel position in a microsatellite.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by lh332k

If I understand you correctly, you are saying that this will inflate the number of variants, since many have ambiguous positions? Interesting - do aligners generally guarantee that such ambiguous variants are consistently placed for forward and reverse reads?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ketil4.0k
2

BWA always places the indel at the beginning of a microsatellite. If you align the read to the rev-complemented ref, the indel will be at the end. Many indel callers assume the bwa behavior, though there are also tools to left-align indels.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by lh332k

Isn't this just POS+length(SEQ)? I'm having doubts now...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Leonor Palmeira3.7k
2

that only applies if the sequence contains only matches or mismatches, this means edit strings that are composed of a number followed by M (like 76M) . For all other alignments you will need to parse the CIGAR string and build the end coordinate from the start + numbers in the edit string.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Istvan Albert ♦♦ 84k

Phew... I'm glad I only have matches and mismatches, so I fall in the easy category :-) Thanks a lot for adding this information, this can be a big trap!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Leonor Palmeira3.7k

I have a perl parser that will change the read length bases on the cigar if you ever want / need it.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Zev.Kronenberg11k

Thanks a lot! I'll keep that in mind! Or maybe you can share it here as a Tool? or as an answer to this thread : Mapping Reads With Bwa And Bowtie ?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by Leonor Palmeira3.7k
4
gravatar for JC
8.0 years ago by
JC10k
Mexico
JC10k wrote:

I made one a few months ago. I launched a heavy process in a pay-per-use cluster, it was running for one week. I thought, 6 pennies/hr cannot be too much money. I received a bill for $832 usd. I'm not using this cluster again unless I estimate the total cost of the process.

edit: the price is per core

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.0 years ago by JC10k

By my count, 6 pennies per hour is $1.44 a day or about $10 a week. How did you get $832?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ryan Thompson3.4k

maybe its price per CPU and depending upon the size of cluster, BAM!!!

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Sukhdeep Singh10k

I used ALL the cores ...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by JC10k

Ah well, 6 pennies per CPU-hour is a little different, isn't it? :)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ryan Thompson3.4k

yes, but it was not clear in the service description from our local provider

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by JC10k
4
gravatar for Michael Dondrup
5.0 years ago by
Bergen, Norway
Michael Dondrup47k wrote:

Possibly: implementing methods that magically generate p-values from non-replicated RNA-seq experiments, possibly as a result to pressure from 'experimentalists'. I really would like to know the history behind their implementation (where they forced by reviewers, or by other groups?). Now we have to explain why those p-values are bogus, and why there are so little significantly differentially expressed genes detected in a non-replicated analysis.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 5.0 years ago by Michael Dondrup47k
4
gravatar for tiago211287
4.9 years ago by
tiago2112871.2k
USA
tiago2112871.2k wrote:

When using scp, I did this:

scp -r somename@somehost:$home ~/

instead of $home, should use ~/

this created a file named $home in my other account.

used rm $home

and kabum!

should pay attention and look how remove this kind of file before.

ADD COMMENTlink modified 8 months ago by RamRS27k • written 4.9 years ago by tiago2112871.2k
4
gravatar for Nicola Casiraghi
4.3 years ago by
Germany, Heidelberg, DKFZ EMBL
Nicola Casiraghi450 wrote:

I spent hours to implement R parallel script to fully exploit 64 cores and 250 GB RAM of the server lab. Thus, really proud of myself, I run it on my 4 cores and 8 GB RAM desktop pc. Boom.

ADD COMMENTlink written 4.3 years ago by Nicola Casiraghi450
3
gravatar for Eric Normandeau
9.3 years ago by
Quebec, Canada
Eric Normandeau10k wrote:

Losing an hour to learn that some files saved on a Mac have a strange 'beginning of file' like character...

Normalize file standards already! x_o

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Eric Normandeau10k
3
gravatar for Sukhdeep Singh
8.2 years ago by
Netherlands
Sukhdeep Singh10k wrote:

My common one cat aVeryBigFile.whatever &

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Sukhdeep Singh10k
6

can't you just fg then ctrl-c?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by brentp23k
2

@brentp, @Daniel cool guys, now this mistake can be rectified :)

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Sukhdeep Singh10k
2

if you don't have other cat job running, you can also type killall cat. Even if you don't see your input, it should work.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by Manu Prestat4.0k
1

just kill -9 $PID from another session, no?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Simon Cockell7.3k
1

Good thought but, on a server (I should have told earlier, I commit this on server sessions), your process id's in one login are not known in other login/session.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Sukhdeep Singh10k
7

I'm pretty sure that ps aux | grep cat from another session will give you the PID of any running cat process on the server.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by Daniel Standage3.9k
3
gravatar for bw.
8.2 years ago by
bw.150
San Francisco
bw.150 wrote:

Running the bwa/GATK pipeline with a corrupt/incompletely generated bwa index of hg19. Everything still aligned, but one of 2 mates would have its strand set incorrectly. Other than the insert size distribution, everything seemed normal, until the TableRecalibration step downshifted all quality scores significantly and then UnifiedGenotyper called 0 SNPs. 1st time I've seen a problem with step 1 of a pipeline not become obvious until step 5+.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.2 years ago by bw.150
3
gravatar for 5heikki
4.8 years ago by
5heikki8.9k
Finland
5heikki8.9k wrote:

I had another good one recently. I was executing an untested bash script for generation of output from two input files on our cluster. I just let it run over night. When I checked in the morning, it had generated about 40 TB worth of output (expectation was about 20 MB). There was a tiny spelling mistake that led to an infinite loop. Oops. I was lucky to check it when I did because there was still a few TB space left so at least other jobs didn't get killed because of it..

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by 5heikki8.9k
2
gravatar for Andra Waagmeester
9.3 years ago by
Maastricht, the Netherlands
Andra Waagmeester3.2k wrote:

What about building an interface not aimed at a community of (fellow) Biologists?

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Andra Waagmeester3.2k
2

that might be stupid and it might be a mistake but it isn't a "stupid mistake". see comments under Chris Evelo's post.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Jeremy Leipzig19k
1

Then I will conclude with the same comment as Chris.

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Andra Waagmeester3.2k
2
gravatar for Russh
9.3 years ago by
Russh1.2k
U. Liverpool
Russh1.2k wrote:
s/foo/bar/g

without the g at the end

as I just proved in the field

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.3 years ago by Russh1.2k
1

I have an opposite mistake. I accidentally replace a string in the whole document and something I didn't want to replace gets replaced. Now I visually select the area where I want to replace...

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Sequencegeek740
2
gravatar for Gww
9.1 years ago by
Gww2.7k
Canada
Gww2.7k wrote:

Making claims without experimental validation. Especially involving studies utilizing multiplexed technologies such as microarrays and high-throughput sequencing.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 9.1 years ago by Gww2.7k
2
gravatar for Rm
8.1 years ago by
Rm8.0k
Danville, PA
Rm8.0k wrote:

Just read this article: "How Not To Be A Bioinformatician" Thought it would be interesting to post here....

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by Rm8.0k
2

Then this might fit as well: "How to be a bioinformatician"

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 6.2 years ago by Christian2.9k
2
gravatar for kajendiran56
8.1 years ago by
kajendiran56120
kajendiran56120 wrote:

Some really great comments here, nice to know that such things happen to all genii ;). I have to say my most painful moments relate to my assumption that data obtained elsewhere is correct in every way. I also remember early in my career, using PDB files and realising that sometimes, chains are represented more than once, thus when manually checking calculations involving atomic coordinates, being utterly perplexed and wanting to break my computer. Oh the joys of Bioinformatics.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 8.1 years ago by kajendiran56120
2
gravatar for Ryan Thompson
7.7 years ago by
Ryan Thompson3.4k
TSRI, La Jolla, CA
Ryan Thompson3.4k wrote:

Using a statistical test on data that does not satisfy the assumptions of that test.

For example, finding differentially-expressed genes by doing ANOVA on log2(FPKM).

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ryan Thompson3.4k
2
gravatar for Ryan Thompson
7.7 years ago by
Ryan Thompson3.4k
TSRI, La Jolla, CA
Ryan Thompson3.4k wrote:

Assuming that the gene IDs in "knownGenes.gtf" from UCSC are actually gene IDs. Instead they just put the transcript ID as the gene ID.

This just caused me a bit of pain when doing read counting at the gene level. Basically, any constitutive exon in a gene with multiple splice forms was ignored because all the reads in that exon were treated as ambiguous.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by Ryan Thompson3.4k
2
gravatar for axelwilhelm
7.7 years ago by
axelwilhelm100
Sweden
axelwilhelm100 wrote:

Using the same output (> oh.shit) for multiple commands.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.7 years ago by axelwilhelm100
2
gravatar for Leszek
7.2 years ago by
Leszek4.0k
IIMCB, Poland
Leszek4.0k wrote:

I found myself guilty iterating through the loop and storing data let's say every 100 iterations... but not storing the very last bit of the data (ie lines 10001 to 10026) at the very end.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by Leszek4.0k
2
gravatar for Prakki Rama
6.2 years ago by
Prakki Rama2.4k
Singapore
Prakki Rama2.4k wrote:

These are just a few, but thought worth sharing:

  • Not having a copy of VERY IMPORTANT file as backup.
  • Forgetting to save parameters used, while running a tool and again start hunting them after few days.
  • Irrelevant folder/file names, especially not having extensions like fasta or fastq at the end of file.
  • Not having a consolidated folder/place, where all scripts and programs lie.
  • Upgrading OS without IT support or prior knowledge, and completely losing the GUI, which needs reinstall of OS again.
  • using UNIQ command in linux, without SORTING the data.
  • Not removing trailing and leading space of variable, before matching it.
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 6.2 years ago by Prakki Rama2.4k
2
gravatar for Antonio R. Franco
4.8 years ago by
Spain. Universidad de Córdoba
Antonio R. Franco4.5k wrote:

I am not joking,

how about forgetting to have a full loaded battery for your wireless keyboard and/or mouse near you, and the current one inside is running out of power?

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by Antonio R. Franco4.5k
1

It depends, how long did it take to notice you were typing and nothing happened?

ADD REPLYlink modified 6 weeks ago by RamRS27k • written 4.7 years ago by h.mon30k
1

sometimes a long time.. :-))

ADD REPLYlink modified 7 months ago by RamRS27k • written 4.7 years ago by Antonio R. Franco4.5k
2
gravatar for Lesley Sitter
4.8 years ago by
Lesley Sitter490
Netherlands
Lesley Sitter490 wrote:

How about writing a tool and being convinced it works perfectly, so you start testing it on a complete dataset instead of testing it first on a subset and finding out after it ran for an hour or so that you made a tiny mistake somewhere. Sooo much time wasted that I'll never get back :P

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by Lesley Sitter490
2
gravatar for abascalfederico
4.8 years ago by
abascalfederico1.1k
Spain
abascalfederico1.1k wrote:

I have spent hours, in repeated occasions, looking for a mysterious error in a perl script that at the end was simply a = instead of a == within an IF statement.

Another recurrent mistake: not documenting what I did and what those scripts do in the belief that everything is so intuitive, organised, simple and natural that it won't be necessary. Then, sometime after, I have to spend hours trying to guess what all that mess was.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by abascalfederico1.1k
2
gravatar for elia.brodsky
4.8 years ago by
elia.brodsky330
United States
elia.brodsky330 wrote:

Spending a few months to find an interesting correlation in data and then presenting to the lab that sequenced to find out they changed coverage on the last few samples!

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by elia.brodsky330
2
gravatar for 5heikki
4.3 years ago by
5heikki8.9k
Finland
5heikki8.9k wrote:

This one was really good, embarking on sudo yum update when there was lots of stuff to update and swap space was very low. Ended up with a situation much like this. Took me good four hours before I saw my desktop again.

ADD COMMENTlink written 4.3 years ago by 5heikki8.9k
2
gravatar for 5heikki
4.3 years ago by
5heikki8.9k
Finland
5heikki8.9k wrote:

Another fun one is when you develop a pipeline with a small test set thinking speed over all and then you increase your test set size and realize that you're creating TBs of temp data and utilizing hundreds of GBs of RAM :)

ADD COMMENTlink written 4.3 years ago by 5heikki8.9k
2
gravatar for T
4.3 years ago by
T40
Germany
T40 wrote:

Chromosome Identifiers - UCSC "chr1" - Ensembl "1"

Produces very confusing outputs ...

ADD COMMENTlink written 4.3 years ago by T40
2
gravatar for Chen
2.8 years ago by
Chen990
Chen990 wrote:

Since no one mentioned.

The uppercase/lowercase error.

Sometimes, you need to distinguish between "atgc" and "ATGC". But in most cases, they mean the same thing. So always convert any string you met to uppercase if you do not need to distinguish.

I feel spending my whole Ph.D. debugging this. Hope it helps for others.

ADD COMMENTlink modified 2.8 years ago • written 2.8 years ago by Chen990
2
gravatar for ATpoint
2.8 years ago by
ATpoint36k
Germany
ATpoint36k wrote:
rm foo *

instead of

rm foo*

and there goes all the content.

ADD COMMENTlink written 2.8 years ago by ATpoint36k
-i

is your friend here

ADD REPLYlink modified 2.8 years ago • written 2.8 years ago by Gjain5.5k
1
gravatar for Manu Prestat
7.2 years ago by
Manu Prestat4.0k
Lyon, France
Manu Prestat4.0k wrote:

A double mistake combo, 1 - use tar to compress a single file and, 2 - inverting the command arguments

tar cvfz file file.tgz

instead of

tar cvfz file.tgz file

Bye bye file!

It happened to me so many times, that I was considering doing an imagery brain check up.

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 7.2 years ago by Manu Prestat4.0k
1
gravatar for Christian
6.2 years ago by
Christian2.9k
Cambridge, US
Christian2.9k wrote:
  • Forgetting that human chromosomes are named differently by UCSC and Ensembl (UCSC names have the 'chr' prefix)
  • Assuming the alphabetical order of human chromosome names is "chr1", "chr2", "chr3", ... when in fact it is "chr1", "chr10", "chr11", ...
  • Forgetting that there is a fifth possible character in a DNA sequence: N (for unknown)
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 6.2 years ago by Christian2.9k

You also occasionally see IUPAC codes pop up in fasta sequences.

ADD REPLYlink modified 6 months ago by RamRS27k • written 6.2 years ago by Chris Miller21k
1
gravatar for Bioinformatics_NewComer
5.6 years ago by
Genomic Island
Bioinformatics_NewComer320 wrote:
  1. Forgot to use -n in numerical sorting of positions in a bed file.
  2. Not using -k flag in sort for a specific column, instead sorting all possible stuff in it.
ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 5.6 years ago by Bioinformatics_NewComer320
1
gravatar for always_learning
4.8 years ago by
always_learning1.0k
Doha, Qatar
always_learning1.0k wrote:

Mixing between hg18, hg19 and yes new one GrCh 38 too !! :)

ADD COMMENTlink modified 6 weeks ago by RamRS27k • written 4.8 years ago by always_learning1.0k
1
gravatar for ssv.bio
3.7 years ago by
ssv.bio180
ssv.bio180 wrote:

Over estimating future me when I was younger or present me cussing younger me :). Commenting is imp as old me understands that.

ADD COMMENTlink modified 3.7 years ago • written 3.7 years ago by ssv.bio180
1
gravatar for confusedious
3.7 years ago by
confusedious420
Australia
confusedious420 wrote:

A very general one:

Using packages without trying to understand what they actually do.

A more specific one:

Assume that the human mitochondrial reference sequence is the ancestral sequence.

ADD COMMENTlink written 3.7 years ago by confusedious420
1
gravatar for Venkatesh Chellappa
3.3 years ago by
Stockholm
Venkatesh Chellappa10 wrote:

Opening a .clc file in terminal only to find out it was a binary! #facepalm

ADD COMMENTlink written 3.3 years ago by Venkatesh Chellappa10
1
gravatar for mforde84
2.8 years ago by
mforde841.2k
mforde841.2k wrote:

Running statistical analyses with no understanding of the tests your using, why you're using them, when it's appropriate to use them, how your data needs to be formated, normalize, or scaled to use them... but hey, you made a volcano plot... so it must be publication quality. right? read the damn paper...

ADD COMMENTlink modified 2.8 years ago • written 2.8 years ago by mforde841.2k
1
gravatar for mforde84
2.8 years ago by
mforde841.2k
mforde841.2k wrote:

drawingbiological insights into a dataset solely from GO enrichment analysis

ADD COMMENTlink written 2.8 years ago by mforde841.2k
1
gravatar for mforde84
2.8 years ago by
mforde841.2k
mforde841.2k wrote:

using sudo, dd, parted or any combination thereof ... like a moron.

ADD COMMENTlink written 2.8 years ago by mforde841.2k
0
gravatar for mforde84
2.8 years ago by
mforde841.2k
mforde841.2k wrote:

my personal favorite is irreparably breaking your xsession, or breaking a mount point so you can't boot past initramfs

ADD COMMENTlink written 2.8 years ago by mforde841.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2124 users visited in the last hour